Stem-loop sequence ssc-mir-130a

AccessionMI0008217 (change log)
DescriptionSus scrofa miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

10 open access papers mention ssc-mir-130a
(19 sentences)

Stem-loop 
     -      a        c      ug  a   ucugca 
5' cg ggccgg gcucuuuu acauug  cu cug      c
   || |||||| |||||||| ||||||  || |||       
3' gc ccgguu cgggaaaa uguaac  ga gau      c
     a      a        u      gu  c   cacuau
Get sequence
Deep sequencing
516 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 12929884-12929962 [-]
intergenic
Database links

Mature sequence ssc-miR-130a

Accession MIMAT0007758
Sequence

50 -  

cagugcaauguuaaaagggcau

 - 71

Get sequence
Deep sequencing509 reads, 14 experiments
Evidence experimental; cloned [1,3], Illumina [2,4-5]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).