![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-16-2 |
||||||
Accession | MI0008212 (change log) | |||||
Previous IDs | ssc-mir-16-1 | |||||
Description | Sus scrofa miR-16-2 stem-loop | |||||
Gene family | MIPF0000006; mir-15 | |||||
Literature search |
![]()
21 open access papers mention ssc-mir-16-2 | |||||
Stem-loop |
cag c - a c u gauu 5' ugc uuagcagcac gu aauauugg g uaa c ||| |||||||||| || |||||||| | ||| 3' aug agucgucgug ca uuaugacc c auu u gga a u a u u aaaa |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence ssc-miR-16 |
|
Accession | MIMAT0007754 |
Sequence |
9 - uagcagcacguaaauauuggcg - 30 |
Deep sequencing | 16097 reads, 15 experiments |
Evidence | experimental; cloned [1,3], Illumina [2,4-5] |
References |
|
1 |
PMID:18548309
"Identification and characterization of new microRNAs from pig"
Mamm Genome. 19:570-580(2008).
|
2 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
3 |
PMID:20180025
"Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
Mol Biol Rep. 37:3567-3574(2010).
|
4 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
5 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|