Stem-loop sequence ssc-mir-15a

Accession

MI0008211 (change log)

Description

Sus scrofa miR-15a stem-loop

Gene family

MIPF0000006; mir-15

Literature search

20 open access papers mention ssc-mir-15a
(90 sentences)

Stem-loop

   uuggaguaaa ua        ua          ga  u 
5'           g  gcagcaca  augguuugug  uu u
             |  ||||||||  ||||||||||  || g
3'           c  cgucgugu  uaccggacgu  aa a
   aacauaaaaa uc        ua          gg  a 

Deep sequencing

1566 reads, 100 reads per million, 14 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chrUScaf2048: 70414-70492 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ssc-mir-15a

• ssc-mir-15a: chrUScaf2048: 70414-70492 [+]
• ssc-mir-16-2: chrUScaf2048: 70557-70635 [+]

Database links

• EntrezGene:MIR15A
• miRBase Tracker:MI0008211

Mature sequence ssc-miR-15a

• Accession: MIMAT0007753
• Sequence: 12 - uagcagcacauaaugguuugu - 32
• Deep sequencing: 1561 reads, 14 experiments
• Evidence: experimental; cloned [1,3], Illumina [2,4-5]

References

1. PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3. PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).