Stem-loop sequence cfa-mir-320

AccessionMI0008063 (change log)
DescriptionCanis familiaris miR-320 stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   --        uu       c      g 
5'   gccuucuc  cccgguu uucccg a
     ||||||||  ||||||| ||||||  
3'   cgggagag  gggucga aagggc g
   ag        uu       a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr25: 35016676-35016729 [+]
intergenic
Database links

Mature sequence cfa-miR-320

Accession MIMAT0006658
Sequence

33 - 

aaaagcuggguugagagggcga

 - 54

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).