Stem-loop sequence cfa-mir-199-1

AccessionMI0008042 (change log)
DescriptionCanis familiaris miR-199-1 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   --       u        c   ------     g 
5'   ccagugu cagacuac ugu      ucagg g
     ||||||| |||||||| |||      |||||  
3'   gguuaca gucugaug aca      agucu g
   uu       c        -   ugugua     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr20: 50410924-50410984 [+]
sense
ENSCAFT00000032564 ; cfa-mir-199-1-201; exon 1
antisense
ENSCAFT00000028009 ; DNM2-201; intron 15
Database links

Mature sequence cfa-miR-199

Accession MIMAT0006642
Sequence

41 - 

acaguagucugcacauugguu

 - 61

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).