Stem-loop sequence cfa-mir-148a

AccessionMI0008018 (change log)
DescriptionCanis familiaris miR-148a stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
   --         -  -a    cc    -   aa 
5'   aaaguucug ag  cacu  gacu cug  u
     ||||||||| ||  ||||  |||| |||  a
3'   uuucaagac uc  guga  cuga gau  u
   ug         a  ac    --    a   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr14: 39301847-39301906 [-]
sense
ENSCAFT00000032654 ; cfa-mir-148a-201; exon 1
Database links

Mature sequence cfa-miR-148a

Accession MIMAT0006622
Sequence

39 - 

ucagugcacuacagaacuuugu

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).