Stem-loop sequence cfa-mir-24-1

AccessionMI0008010 (change log)
DescriptionCanis familiaris miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
   --g  g   a         ua     ucuca 
5'    gu ccu cugagcuga  ucagu     u
      || ||| |||||||||  |||||     u
3'    ca gga gacuugacu  gguca     g
   gga  a   c         -c     cacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 71677608-71677669 [-]
antisense
ENSCAFT00000001991 ; FANCC-202; intron 12
Clustered miRNAs
< 10kb from cfa-mir-24-1
cfa-mir-23bchr1: 71678353-71678406 [-]
cfa-mir-27bchr1: 71678117-71678179 [-]
cfa-mir-24-1chr1: 71677608-71677669 [-]
Database links

Mature sequence cfa-miR-24

Accession MIMAT0006614
Sequence

40 - 

uggcucaguucagcaggaacagg

 - 62

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).