Stem-loop sequence cfa-mir-27b

AccessionMI0008009 (change log)
DescriptionCanis familiaris miR-27b stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   --            auug        ugac     
5'   agagcuuagcug    gugaacag    uggu 
     ||||||||||||    ||||||||    ||| u
3'   ucuugaaucggu    cacuuguu    gccu 
   cg            --ga        --uc     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 71678117-71678179 [-]
sense
ENSCAFT00000032681 ; cfa-mir-27b-201; exon 1
antisense
ENSCAFT00000001991 ; FANCC-202; intron 12
Clustered miRNAs
< 10kb from cfa-mir-27b
cfa-mir-23bchr1: 71678353-71678406 [-]
cfa-mir-27bchr1: 71678117-71678179 [-]
cfa-mir-24-1chr1: 71677608-71677669 [-]
Database links

Mature sequence cfa-miR-27b

Accession MIMAT0006613
Sequence

43 - 

uucacaguggcuaaguucugc

 - 63

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).