Stem-loop sequence cfa-mir-30c-2

AccessionMI0008001 (change log)
DescriptionCanis familiaris miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   --u       u   aca         guggaa 
5'    guaaaca ccu   cucucagcu      a
      ||||||| |||   |||||||||       
3'    cauuugu gga   gagggucga      g
   ucu       c   --a         aagaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr12: 33757899-33757960 [-]
sense
ENSCAFT00000032664 ; cfa-mir-30c-2-201; exon 1
Database links

Mature sequence cfa-miR-30c

Accession MIMAT0006605
Sequence

1 - 

uguaaacauccuacacucucagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).