Stem-loop sequence vvi-MIR482

AccessionMI0007971 (change log)
DescriptionVitis vinifera miR482 stem-loop
Gene family MIPF0000403; MIR482
Literature search

7 open access papers mention vvi-MIR482
(15 sentences)

Stem-loop 
   --aauguu       u    -          c     ca    uu    ----      uuu 
5'         ugggaau ggag aguaggaaag uuagc  ucua  cccu    ucaugg   c
           ||||||| |||| |||||||||| |||||  ||||  ||||    ||||||    
3'         auccuua ccuc ucauccuuuc gaucg  agau  gggg    gguacc   c
   cuuuuguu       c    c          u     --    cu    guua      ucu
Get sequence
Deep sequencing
15116 reads, 1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 5523024-5523140 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR482
vvi-MIR3633bchr17: 5521567-5521678 [+]
vvi-MIR3633achr17: 5521907-5522061 [+]
vvi-MIR482chr17: 5523024-5523140 [+]
Database links

Mature sequence vvi-miR482

Accession MIMAT0006576
Sequence

86 -  

ucuuuccuacuccucccauucc

 - 107

Get sequence
Deep sequencing1067 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).