Stem-loop sequence vvi-MIR403e

AccessionMI0007968 (change log)
DescriptionVitis vinifera miR403e stem-loop
Gene family MIPF0000290; MIR403
Literature search

2 open access papers mention vvi-MIR403e
(5 sentences)

Stem-loop 
   --   c   u a                a   cc a   u gc     auaucuu    ua 
5'   gca auc c aguuugugcgugaauc aac  c ucg a  cgucc       cgug  c
     ||| ||| | |||||||||||||||| |||  | ||| |  |||||       ||||  u
3'   ugu uag g ucaaacacgcacuuag uug  g agc u  gcggg       gcac  a
   cc   c   c c                a   cc c   - ua     -------    ua
Get sequence
Deep sequencing
339 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr5: 168099-168213 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR403e
vvi-MIR403dchr5: 166482-166567 [+]
vvi-MIR403echr5: 168099-168213 [+]
Database links

Mature sequence vvi-miR403e

Accession MIMAT0006573
Sequence

85 -  

uuagauucacgcacaaacucg

 - 105

Get sequence
Deep sequencing336 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).