Stem-loop sequence vvi-MIR403d

AccessionMI0007967 (change log)
DescriptionVitis vinifera miR403d stem-loop
Gene family MIPF0000290; MIR403
Literature search

2 open access papers mention vvi-MIR403d
(5 sentences)

Stem-loop 
   --acaaac              c     --ca      caaucu 
5'         cucgaguuugugcg gaauc    accccu      u
           |||||||||||||| |||||    ||||||       
3'         gggcucaaacacgc cuuag    ugggga      c
   ucugucua              a     auug      aacuuu
Get sequence
Deep sequencing
344 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr5: 166482-166567 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR403d
vvi-MIR403dchr5: 166482-166567 [+]
vvi-MIR403echr5: 168099-168213 [+]
Database links

Mature sequence vvi-miR403d

Accession MIMAT0006572
Sequence

56 -  

uuagauucacgcacaaacucg

 - 76

Get sequence
Deep sequencing339 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).