Stem-loop sequence vvi-MIR403a

AccessionMI0007964 (change log)
DescriptionVitis vinifera miR403a stem-loop
Gene family MIPF0000290; MIR403
Literature search

2 open access papers mention vvi-MIR403a
(9 sentences)

Stem-loop 
   g  cau    --                a   c  a   u gc     --------a    u 
5'  ca   cuca  aguuugugcgugaauc aac cc ucg a  cgucc         uauc u
    ||   ||||  |||||||||||||||| ||| || ||| |  |||||         ||||  
3'  gu   gagu  ucaaacacgcacuuag uug gg agc u  gcggg         augg c
   a  cuu    gc                a   c  c   - ua     gcacuaauc    g
Get sequence
Deep sequencing
337 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr5: 65247-65361 [+]
intergenic
Database links

Mature sequence vvi-miR403a

Accession MIMAT0006569
Sequence

85 -  

uuagauucacgcacaaacucg

 - 105

Get sequence
Deep sequencing334 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).