Stem-loop sequence vvi-MIR169w

AccessionMI0007948 (change log)
DescriptionVitis vinifera miR169w stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169w
(21 sentences)

Stem-loop 
   ----   uau ug   c   c                 aacu  c   a    -   --c   c         - uu 
5'     ggu   g  gug agc aaggaugacuugccggc    cc uuu uugu acu   aug augcucaua c  a
       |||   |  ||| ||| |||||||||||||||||    || ||| |||| |||   ||| ||||||||| |  u
3'     ccg   c  uac ucg uucuuacugagcggcug    gg aaa aacg uga   uac uacgggugu g  a
   uacu   --u uu   a   a                 --gu  u   -    g   auu   -         u uc
Get sequence
Deep sequencing
5503 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr14: 29685614-29685756 [+]
intergenic
Database links

Mature sequence vvi-miR169w

Accession MIMAT0006553
Sequence

13 -  

cagccaaggaugacuugccgg

 - 33

Get sequence
Deep sequencing5502 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).