Stem-loop sequence vvi-MIR169o

AccessionMI0007945 (change log)
DescriptionVitis vinifera miR169o stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169o
(16 sentences)

Stem-loop 
   ---a    g auu                   c -    - ag   --c    au 
5'     gggu g   ugagccaaggaugacuugc g ccau c  cag   aagc  u
       |||| |   ||||||||||||||||||| | |||| |  |||   ||||   
3'     cccg c   acucgguucuuauugagcg c ggua g  guc   uucg  g
   ucuc    g -gu                   a a    c -g   aau    aa
Get sequence
Deep sequencing
5642 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16190330-16190432 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR169o
vvi-MIR169lchr11: 16185290-16185392 [+]
vvi-MIR169ochr11: 16190330-16190432 [+]
Database links

Mature sequence vvi-miR169o

Accession MIMAT0006550
Sequence

12 -  

gagccaaggaugacuugccgc

 - 32

Get sequence
Deep sequencing5639 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).