Stem-loop sequence vvi-MIR169l

Accession

MI0007943 (change log)

Description

Vitis vinifera miR169l stem-loop

Gene family

MIPF0000037; MIR169_2

Literature search

8 open access papers mention vvi-MIR169l
(16 sentences)

Stem-loop

   ---a    g    u               u     ccuuugcaucaagcauu 
5'     gggu gaau gagccaaggaugacu gccgu                 g
       |||| |||| ||||||||||||||| |||||                 a
3'     cccg uuua cucgguucuuauuga cggca                 a
   ucuc    g    -               u     cguacgggucaauuucg 

Deep sequencing

5649 reads, 350 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (12X; GCA_000003745.2): chr11: 16185290-16185392 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from vvi-MIR169l

• vvi-MIR169l: chr11: 16185290-16185392 [+]
• vvi-MIR169o: chr11: 16190330-16190432 [+]

Database links

• EntrezGene:MIR169L
• miRBase Tracker:MI0007943

Mature sequence vvi-miR169l

• Accession: MIMAT0006548
• Sequence: 12 - gagccaaggaugacuugccgu - 32
• Deep sequencing: 5642 reads, 2 experiments
• Evidence: experimental; Array [2]

References

1. PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2. PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).