Stem-loop sequence vvi-MIR169i

Accession

MI0007942 (change log)

Description

Vitis vinifera miR169i stem-loop

Gene family

MIPF0000037; MIR169_2

Literature search

8 open access papers mention vvi-MIR169i
(17 sentences)

Stem-loop

   ---a    gg  uu   c  a       ug     -   uuu        uauu 
5'     gggu  aa  gag ca ggaugac  gccgu cau   ucaguugg    u
       ||||  ||  ||| || |||||||  ||||| |||   ||||||||    g
3'     cucg  uu  cuc gu ccuauug  cggca gua   ggucaauu    a
   ucuc    -a  uc   u  c       gu     c   -cu        ucgg 

Deep sequencing

2205 reads, 100 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (12X; GCA_000003745.2): chr11: 16158014-16158118 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from vvi-MIR169i

• vvi-MIR169h: chr11: 16151651-16151751 [+]
• vvi-MIR169i: chr11: 16158014-16158118 [+]

Database links

• EntrezGene:MIR169I
• miRBase Tracker:MI0007942

Mature sequence vvi-miR169i

• Accession: MIMAT0006547
• Sequence: 12 - gagccaaggaugacuggccgu - 32
• Deep sequencing: 2199 reads, 2 experiments
• Evidence: experimental; Array [2]

References

1. PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2. PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).