Stem-loop sequence vvi-MIR169h

AccessionMI0007941 (change log)
DescriptionVitis vinifera miR169h stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169h
(15 sentences)

Stem-loop 
   ---a    gg  uu   c           ug    ccuu   c    u    g 
5'     gggu  aa  gag caaggauggcu  ccgu    ugu acua uuga g
       ||||  ||  ||| |||||||||||  ||||    ||| |||| ||||  
3'     cucg  uu  cuc guuccuauugg  ggca    gca uggu aauu c
   ucuc    -a  uc   a           ga    ---c   c    c    a
Get sequence
Deep sequencing
1340 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16151651-16151751 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR169h
vvi-MIR169hchr11: 16151651-16151751 [+]
vvi-MIR169ichr11: 16158014-16158118 [+]
Database links

Mature sequence vvi-miR169h

Accession MIMAT0006546
Sequence

11 -  

ugagccaaggauggcuugccg

 - 31

Get sequence
Deep sequencing1334 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).