Stem-loop sequence vvi-MIR169b

AccessionMI0007940 (change log)
DescriptionVitis vinifera miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169b
(16 sentences)

Stem-loop 
   ---          u               u     -   c     -c         
5'    ggggucgaau gagccaaggauggcu gccgu cau ugcag  aagaguug 
      |||||||||| ||||||||||||||| ||||| ||| |||||  ||||||| g
3'    ucccgguuua cucgguuccuacuga uggca gug guguc  uuuucaga 
   ucu          -               u     c   c     aa
Get sequence
Deep sequencing
1336 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16265437-16265541 [+]
intergenic
Database links

Mature sequence vvi-miR169b

Accession MIMAT0006545
Sequence

11 -  

ugagccaaggauggcuugccg

 - 31

Get sequence
Deep sequencing1330 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).