![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-199a-2 |
|||||
Accession | MI0007662 (change log) | ||||
Description | Macaca mulatta miR-199a-2 stem-loop | ||||
Gene family | MIPF0000040; mir-199 | ||||
Literature search |
2 open access papers mention mml-mir-199a-2 | ||||
Stem-loop |
aac u c u g ag c 5' gcc ccagugu cagacuac ugu ca g g u ||| ||||||| |||||||| ||| || | | 3' cgg gguuaca gucugaug aca gu c c c auu c - u g aa u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mml-miR-199a-5p |
|
Accession | MIMAT0006231 |
Sequence |
6 - cccaguguucagacuaccuguuc - 28 |
Deep sequencing | 15027 reads, 9 experiments |
Evidence | by similarity; MI0000242 |
Database links |
|
Predicted targets |
|
Mature sequence mml-miR-199a-3p |
|
Accession | MIMAT0006232 |
Sequence |
47 - acaguagucugcacauugguua - 68 |
Deep sequencing | 178627 reads, 9 experiments |
Evidence | by similarity; MI0000242 |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|