Stem-loop sequence mml-mir-133b

Accession

MI0007622 (change log)

Description

Macaca mulatta miR-133b stem-loop

Gene family

MIPF0000029; mir-133

Literature search

2 open access papers mention mml-mir-133b
(2 sentences)

Stem-loop

   c   a  a  --aa  --    --       c        ca  c  a      u  g      
5'  cuc ga ga    ga  ugcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
    ||| || ||    ||  ||||  ||||||| ||||||||  || || |||||| || |||| c
3'  gag uu cu    cu  acgg  gggacga aucgacca  uu cc ugguuu gg agagu 
   a   g  c  gacc  ua    uc       c        ac  c  c      -  -      

Deep sequencing

24800 reads, 100 reads per million, 9 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Mmul_8.0.1; GCA_000772875.3): chr4: 53110676-53110794 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mml-mir-133b

• mml-mir-206: chr4: 53106130-53106215 [+]
• mml-mir-133b: chr4: 53110676-53110794 [+]

Database links

• EntrezGene:MIR133B
• miRBase Tracker:MI0007622

Mature sequence mml-miR-133b-5p

• Accession: MIMAT0026818
• Sequence: 31 - uggucaaacggaaccaaguc - 50
• Deep sequencing: 2 reads, 1 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetScanVert:mml-miR-133b-5p

Mature sequence mml-miR-133b-3p

• Accession: MIMAT0006189
• Sequence: 66 - uuugguccccuucaaccagcua - 87
• Deep sequencing: 24798 reads, 9 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetScanVert:mml-miR-133b-3p

References

1. PMID:18186931 "Identification of novel homologous microRNA genes in the rhesus macaque genome" Yue J, Sheng Y, Orwig KE BMC Genomics. 9:8(2008).
2. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).