![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-133b |
||||||
Accession | MI0007622 (change log) | |||||
Description | Macaca mulatta miR-133b stem-loop | |||||
Gene family | MIPF0000029; mir-133 | |||||
Literature search |
2 open access papers mention mml-mir-133b | |||||
Stem-loop |
c a a --aa -- -- c ca c a u g 5' cuc ga ga ga ugcc cccugcu uggcuggu aa gg accaag cc ucuuc ||| || || || |||| ||||||| |||||||| || || |||||| || |||| c 3' gag uu cu cu acgg gggacga aucgacca uu cc ugguuu gg agagu a g c gacc ua uc c ac c c - - |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence mml-miR-133b-5p |
|
Accession | MIMAT0026818 |
Sequence |
31 - uggucaaacggaaccaaguc - 50 |
Deep sequencing | 2 reads, 1 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mml-miR-133b-3p |
|
Accession | MIMAT0006189 |
Sequence |
66 - uuugguccccuucaaccagcua - 87 |
Deep sequencing | 24798 reads, 9 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|