![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-26a-2 |
|||||
Accession | MI0007593 (change log) | ||||
Description | Macaca mulatta miR-26a-2 stem-loop | ||||
Gene family | MIPF0000043; mir-26 | ||||
Literature search |
3 open access papers mention mml-mir-26a-2 | ||||
Stem-loop |
gg ug uu c guuucc 5' ggcugu c ga caaguaauc aggauaggcu a |||||| | || ||||||||| |||||||||| 3' ucgacg g cu guucauuag ucuuauccgg u ga gu uu u aguguc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mml-miR-26a-5p |
|
Accession | MIMAT0002349 |
Sequence |
14 - uucaaguaauccaggauaggcu - 35 |
Deep sequencing | 1768705 reads, 9 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Predicted targets |
|
Mature sequence mml-miR-26a-2-3p |
|
Accession | MIMAT0031062 |
Sequence |
52 - ccuauucuugauuacuuguuuc - 73 |
Deep sequencing | 45 reads, 9 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|