Stem-loop sequence gga-mir-1715

AccessionMI0007452 (change log)
DescriptionGallus gallus miR-1715 stem-loop
Literature search

1 open access papers mention gga-mir-1715
(1 sentences)

Stem-loop 
     -cua    -aa     c     -   a    aa         ---  -a     
5' gg    agag   ggaag agagg auc guag  gucagcugu   gc  ggca 
   ||    ||||   ||||| ||||| ||| ||||  |||||||||   ||  ||| g
3' cc    ucuc   ccuuu ucucc ugg cguc  cagucgacg   cg  ucgu 
     aaug    gua     -     a   g    -a         uag  ag
Get sequence
Deep sequencing
16 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 14307704-14307805 [-]
sense
ENSGALT00000014955 ; VRK3-201; intron 4
Database links

Mature sequence gga-miR-1715-5p

Accession MIMAT0007611
Previous IDsgga-miR-1715
Sequence

20 -  

aggaucaguagaagucagcugugc

 - 43

Get sequence
Deep sequencing13 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1715-3p

Accession MIMAT0007612
Previous IDsgga-miR-1715*
Sequence

66 -  

ugacacugcggguaccucuuu

 - 86

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).