Stem-loop sequence gga-mir-199b

Accession

MI0007426 (change log)

Description

Gallus gallus miR-199b stem-loop

Literature search

8 open access papers mention gga-mir-199b
(21 sentences)

Stem-loop

   u    a     --u     --        cuucu 
5'  uuuu ggacu   ugugu  acuacuga     c
    |||| |||||   |||||  ||||||||      
3'  agaa ccugg   acacg  ugaugacu     u
   g    c     uuu     uc        aucuc 

Deep sequencing

4721 reads, 40 reads per million, 5 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr3: 63130917-63130982 [+]
• Overlapping transcripts:

  sense

  ENSGALT00000024023 ; CEP85L-201; intron 4

Database links

• EntrezGene:MIR199B
• miRBase Tracker:MI0007426

Mature sequence gga-miR-199b

• Accession: MIMAT0007583
• Sequence: 39 - caguagucugcacauuuggu - 58
• Deep sequencing: 4721 reads, 5 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:gga-miR-199b
  • miRDB:gga-miR-199b

References

1. PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).