Stem-loop sequence gga-mir-1621

AccessionMI0007350 (change log)
DescriptionGallus gallus miR-1621 stem-loop
Stem-loop
   u    caa -    u  cu      c     c   c 
5'  ucgg   c cggc gc  cggugg accgu ucc g
    ||||   | |||| ||  |||||| ||||| ||| c
3'  agcc   g gccg cg  gccgcu uggca agg u
   g    cac c    c  -u      -     -   c 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 3620263-3620333 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1621
gga-mir-1621chr28: 3620263-3620333 [+]
gga-mir-1565chr28: 3621530-3621611 [+]
gga-mir-9-1chr28: 3623171-3623258 [+]
Database links

Mature sequence gga-miR-1621-5p

Accession MIMAT0007488
Previous IDsgga-miR-1621
Sequence

8 - 

accggcugccucgguggcac

 - 27

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1621-3p

Accession MIMAT0007489
Previous IDsgga-miR-1621*
Sequence

45 - 

gguucgccgugccgccgcgc

 - 64

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).