Stem-loop sequence gga-mir-1565

AccessionMI0007290 (change log)
DescriptionGallus gallus miR-1565 stem-loop
Stem-loop
                   c   g   gucg   ---      guc 
5' gggggcagagccgggc cgg ccc    cgg   ggggag   c
   |||||||||||||||| ||| |||    |||   ||||||   u
3' cccucguuuugguccg gcu ggg    gcc   ccccuc   g
                   u   -   ---a   uag      auu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 3621530-3621611 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1565
gga-mir-1621chr28: 3620263-3620333 [+]
gga-mir-1565chr28: 3621530-3621611 [+]
gga-mir-9-1chr28: 3623171-3623258 [+]
Database links

Mature sequence gga-miR-1565

Accession MIMAT0007425
Sequence

57 - 

cgagggucgugccugguuuugcu

 - 79

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).