![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR1523a |
||||||
Accession | MI0007240 (change log) | |||||
Previous IDs | gma-MIR1523 | |||||
Description | Glycine max miR1523 stem-loop | |||||
Gene family | MIPF0001327; MIR1523 | |||||
Literature search |
1 open access papers mention gma-MIR1523a | |||||
Stem-loop |
aggacc a gg ---------- c uaa 5' cauu ug auaaaugugagcuc aggag gaugaa a |||| || |||||||||||||| ||||| |||||| 3' guaa ac uauuuacacucgag uccuc cuacuu u -----a a uu cccucauuac a ucc |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence gma-miR1523a |
|
Accession | MIMAT0007384 |
Previous IDs | gma-miR1523 |
Sequence |
11 - augggauaaaugugagcuca - 30 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|