Stem-loop sequence gma-MIR1523a

AccessionMI0007240 (change log)
Previous IDsgma-MIR1523
DescriptionGlycine max miR1523 stem-loop
Gene family MIPF0001327; MIR1523
Literature search

1 open access papers mention gma-MIR1523a
(1 sentences)

Stem-loop 
   aggacc    a  gg              ----------     c      uaa 
5'       cauu ug  auaaaugugagcuc          aggag gaugaa   a
         |||| ||  ||||||||||||||          ||||| ||||||    
3'       guaa ac  uauuuacacucgag          uccuc cuacuu   u
   -----a    a  uu              cccucauuac     a      ucc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 12591029-12591123 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR1523a
gma-MIR1523achr2: 12591029-12591123 [-]
gma-MIR1523bchr2: 12591024-12591174 [+]
Database links

Mature sequence gma-miR1523a

Accession MIMAT0007384
Previous IDsgma-miR1523
Sequence

11 -  

augggauaaaugugagcuca

 - 30

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).