Stem-loop sequence gga-mir-216c

AccessionMI0007066 (change log)
Previous IDsgga-mir-1461
DescriptionGallus gallus miR-216c stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   --ugc       ua        a       u     ga  gcu 
5'      cagauug  gaaucucu cagguaa uguga  uu   a
        |||||||  |||||||| ||||||| |||||  ||    
3'      gucugac  uuuagaga guccguu acacu  ag   u
   ucagu       cc        c       u     ac  aaa 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 323485-323570 [+]
antisense
ENSGALT00000035334 ; gga-mir-216b-201; exon 1
Clustered miRNAs
< 10kb from gga-mir-216c
gga-mir-217chr3: 315408-315514 [-]
gga-mir-216achr3: 318076-318181 [-]
gga-mir-216bchr3: 323483-323571 [-]
gga-mir-216cchr3: 323485-323570 [+]
Database links

Mature sequence gga-miR-216c

Accession MIMAT0007339
Previous IDsgga-miR-1461
Sequence

15 - 

aucucuacagguaauugugaga

 - 36

Get sequence
Deep sequencing67 reads, 4 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).