Stem-loop sequence oan-mir-214

AccessionMI0006889 (change log)
DescriptionOrnithorhynchus anatinus miR-214 stem-loop
Gene family MIPF0000062; mir-214
Stem-loop
   -u  gacu      acgga       c   u          aca            aacau 
5'   gg    ggcugg     guuguca gug cugccugucu   cuugcugugcag     c
     ||    ||||||     ||||||| ||| ||||||||||   ||||||||||||     c
3'   uc    ccgacc     caacagu cac gacggacaga   ggacgacauguc     u
   ag  -agu      -----       a   u          cac            cacuc 
Get sequence
Deep sequencing
431 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra341: 2331532-2331649 [-]
antisense
ENSOANT00000001414 ; DNM3-201; intron 13
Clustered miRNAs
< 10kb from oan-mir-214
oan-mir-199Ultra341: 2337896-2338013 [-]
oan-mir-214Ultra341: 2331532-2331649 [-]
Database links

Mature sequence oan-miR-214-5p

Accession MIMAT0007170
Previous IDsoan-miR-214*
Sequence

32 - 

ugccugucuacacuugcugu

 - 51

Get sequence
Deep sequencing150 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-214-3p

Accession MIMAT0007171
Previous IDsoan-miR-214
Sequence

73 - 

acagcaggcacagacaggcagu

 - 94

Get sequence
Deep sequencing281 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).