Stem-loop sequence oan-mir-454

AccessionMI0006881 (change log)
DescriptionOrnithorhynchus anatinus miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   -uua     uc            ---         ----   --u     g 
5'     ccaga  cuggaacccuau   cgauauugu    cuc   gcugu u
       |||||  ||||||||||||   |||||||||    |||   |||||  
3'     gguuu  gauuuugggaua   guuauaacg    gag   cgaua a
   aaag     gu            uuc         ugau   ugu     a 
Get sequence
Deep sequencing
8663 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra324: 523221-523314 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-454
oan-mir-130bUltra324: 532674-532802 [-]
oan-mir-301Ultra324: 531655-531775 [-]
oan-mir-454Ultra324: 523221-523314 [-]
Database links

Mature sequence oan-miR-454-5p

Accession MIMAT0007156
Previous IDsoan-miR-454*
Sequence

16 - 

acccuaucgauauugucucugcu

 - 38

Get sequence
Deep sequencing2054 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-454-3p

Accession MIMAT0007157
Previous IDsoan-miR-454
Sequence

56 - 

uagugcaauauugcuuauagggu

 - 78

Get sequence
Deep sequencing6603 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).