Stem-loop sequence oan-mir-449a

AccessionMI0006793 (change log)
DescriptionOrnithorhynchus anatinus miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ---uu  -aa    cauc  ug        uuu     -               uga  au 
5'      ug   gugg    ug  ugcgauag   ggcag uguuuguuagcuggu   au  u
        ||   ||||    ||  ||||||||   ||||| |||||||||||||||   ||   
3'      ac   cacc    au  acguuauc   ucguc acagacagucgacca   ua  u
   aagcu  gag    ----  gu        cuu     g               cgg  aa 
Get sequence
Deep sequencing
164 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig3432: 5911-6025 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-449a
oan-mir-449cContig3432: 4405-4521 [+]
oan-mir-449bContig3432: 5779-5880 [+]
oan-mir-449aContig3432: 5911-6025 [+]
Database links

Mature sequence oan-miR-449a

Accession MIMAT0007015
Sequence

29 - 

uggcaguguuuguuagcuggu

 - 49

Get sequence
Deep sequencing163 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).