Stem-loop sequence oan-mir-449b

AccessionMI0006792 (change log)
DescriptionOrnithorhynchus anatinus miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
       ca ua     -gu     a     u      uuugc        uu   u 
5' guga  u  ccugg   caagu ggcag gugaug     uggcugcu  gaa c
   ||||  |  |||||   ||||| ||||| ||||||     ||||||||  |||  
3' uacu  g  ggauc   guuca ccguc cauugc     accgacga  cuu g
       ca gc     auc     -     u      ----c        --   a 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig3432: 5779-5880 [+]
intergenic
Contig39133: 803-904 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-449b
oan-mir-449cContig3432: 4405-4521 [+]
oan-mir-449bContig3432: 5779-5880 [+]
oan-mir-449aContig3432: 5911-6025 [+]
Database links

Mature sequence oan-miR-449b-5p

Accession MIMAT0007013
Previous IDsoan-miR-449b
Sequence

22 - 

aggcagugugauguuugcugg

 - 42

Get sequence
Deep sequencing29 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-449b-3p

Accession MIMAT0007014
Previous IDsoan-miR-449b*
Sequence

62 - 

cagccaccguuacucugccacu

 - 83

Get sequence
Deep sequencing14 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).