Stem-loop sequence oan-mir-449c

AccessionMI0006791 (change log)
DescriptionOrnithorhynchus anatinus miR-449c stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ----------------uccauuaa  a    c    uu   a    uuu        g   --u   a 
5'                         ga ugug cggu  ggc gugc   gcuagcug cug   uca u
                           || |||| ||||  ||| ||||   |||||||| |||   ||| a
3'                         cu acac guca  ccg cacg   uggucgac gac   agu a
   agguaaggaaagcgcaacccaaac  a    u    cc   -    --u        -   cuu   a 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig3432: 4405-4521 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-449c
oan-mir-449cContig3432: 4405-4521 [+]
oan-mir-449bContig3432: 5779-5880 [+]
oan-mir-449aContig3432: 5911-6025 [+]
Database links

Mature sequence oan-miR-449c

Accession MIMAT0007012
Sequence

22 - 

uggcagugcuuugcuagcugg

 - 42

Get sequence
Deep sequencing39 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).