Stem-loop sequence oan-mir-27b

AccessionMI0006758 (change log)
DescriptionOrnithorhynchus anatinus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

1 open access papers mention oan-mir-27b
(1 sentences)

Stem-loop
          c   g c      u  c                 auug        u  uug 
5' gccgucu ucu u ucucug cg ggcgcagagcuuagcug    gugaacag ga   c
   ||||||| ||| | |||||| || |||||||||||||||||    |||||||| ||   u
3' cggcagg agg g agagac gc ccgcgucuugaaucggu    cacuuguu cu   g
          c   g a      -  -                 --ga        u  cag 
Get sequence
Deep sequencing
222116 reads, 3.04e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig22293: 6340-6456 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-27b
oan-mir-23bContig22293: 6504-6612 [-]
oan-mir-27bContig22293: 6340-6456 [-]
oan-mir-24-1Contig22293: 5770-5853 [-]
Database links

Mature sequence oan-miR-27b-5p

Accession MIMAT0006956
Previous IDsoan-miR-27b*
Sequence

30 - 

agagcuuagcugauuggugaac

 - 51

Get sequence
Deep sequencing13967 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-27b-3p

Accession MIMAT0006957
Previous IDsoan-miR-27b
Sequence

72 - 

uucacaguggcuaaguucugc

 - 92

Get sequence
Deep sequencing208055 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).