Stem-loop sequence vvi-MIR535a

AccessionMI0006580 (change log)
DescriptionVitis vinifera miR535a stem-loop
Gene family MIPF0000136; MIR535
Literature search

4 open access papers mention vvi-MIR535a
(15 sentences)

Stem-loop 
   --ugua    cu     a                a  ca   u     cg 
5'       auug  ugaca cgagagagagcacgcu gu  gca ucaug  a
         ||||  ||||| |||||||||||||||| ||  ||| |||||  g
3'       uaac  acugu gcucucucucgugcgg ca  ugu aguac  g
   cucuuc    au     c                a  ug   c     aa
Get sequence
Deep sequencing
1745317 reads, 1.16e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr7: 433583-433683 [-]
intergenic
Database links

Mature sequence vvi-miR535a

Accession MIMAT0005735
Sequence

11 -  

ugacaacgagagagagcacgc

 - 31

Get sequence
Deep sequencing1745012 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).