Stem-loop sequence vvi-MIR479

AccessionMI0006579 (change log)
DescriptionVitis vinifera miR479 stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

4 open access papers mention vvi-MIR479
(6 sentences)

Stem-loop 
   ---   g   u  u                  a    cuuucauucau 
5'    gua aca gg gugguauugguucggcuc ucuu           u
      ||| ||| || |||||||||||||||||| ||||            
3'    cgu ugu uc cacuauaaccaagccgag agaa           u
   cuu   a   -  u                  c    acucggcuacu
Get sequence
Deep sequencing
18001 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr16: 21573759-21573852 [+]
intergenic
Database links

Mature sequence vvi-miR479

Accession MIMAT0005734
Sequence

11 -  

ugugguauugguucggcucauc

 - 32

Get sequence
Deep sequencing16327 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).