Stem-loop sequence vvi-MIR399h

AccessionMI0006577 (change log)
DescriptionVitis vinifera miR399h stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention vvi-MIR399h
(10 sentences)

Stem-loop 
   --ag    aa   u     c              -   -uc    a 
5'     gaau  cag gcaau cuccuuuggcagaa aga   augc c
       ||||  ||| ||||| |||||||||||||| |||   ||||  
3'     cuua  guc cguua gaggaaaccguuuu ucu   uacg a
   cucg    cc   c     a              g   uca    u
Get sequence
Deep sequencing
136 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr10: 2983545-2983634 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR399h
vvi-MIR399gchr10: 2981247-2981359 [-]
vvi-MIR399hchr10: 2983545-2983634 [+]
vvi-MIR399dchr10: 2988021-2988125 [-]
vvi-MIR399achr10: 2989450-2989546 [+]
vvi-MIR399echr10: 2992220-2992331 [-]
Database links

Mature sequence vvi-miR399h

Accession MIMAT0005732
Sequence

60 -  

ugccaaaggagaauugcccug

 - 80

Get sequence
Deep sequencing131 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).