Stem-loop sequence vvi-MIR399g

Accession

MI0006576 (change log)

Description

Vitis vinifera miR399g stem-loop

Gene family

MIPF0000015; MIR399

Literature search

4 open access papers mention vvi-MIR399g
(10 sentences)

Stem-loop

   --a       cu      ua    a        u   cacucggcugaccgcgguu 
5'    ugaauug  gggcaa  cucc uuggcagu ggc                   g
      |||||||  ||||||  |||| |||||||| |||                   a
3'    acuuaac  cccguu  gagg aaccguca ucg                   c
   ucg       uc      ua    a        c   aaucagacgaugaacacuu 

Deep sequencing

128 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (12X; GCA_000003745.2): chr10: 2981247-2981359 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from vvi-MIR399g

• vvi-MIR399a: chr10: 2989450-2989546 [+]
• vvi-MIR399d: chr10: 2988021-2988125 [-]
• vvi-MIR399h: chr10: 2983545-2983634 [+]
• vvi-MIR399g: chr10: 2981247-2981359 [-]

Database links

• EntrezGene:MIR399G
• miRBase Tracker:MI0006576

Mature sequence vvi-miR399g

• Accession: MIMAT0005731
• Sequence: 83 - ugccaaaggagauuugccccu - 103
• Deep sequencing: 128 reads, 2 experiments
• Evidence: experimental; Array [2]

References

1. PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2. PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).