Stem-loop sequence vvi-MIR396b

Accession

MI0006570 (change log)

Description

Vitis vinifera miR396b stem-loop

Gene family

MIPF0000047; MIR396

Literature search

5 open access papers mention vvi-MIR396b
(24 sentences)

Stem-loop

   uccu      c                        uucucccuguuu     ucuccuac 
5'     gccaug uuuuccacagcuuucuugaacuuc            ggugg        g
       |||||| ||||||||||||||||||||||||            |||||         
3'     cgguac aaagggugucgaaagaacuugaag            ucacc        u
   --uu      c                        ------------     uacccauu 

Deep sequencing

11550 reads, 600 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (12X; GCA_000003745.2): chr11: 5246790-5246897 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from vvi-MIR396b

• vvi-MIR396b: chr11: 5246790-5246897 [+]
• vvi-MIR396d: chr11: 5253110-5253229 [-]

Database links

• EntrezGene:MIR396B
• miRBase Tracker:MI0006570

Mature sequence vvi-miR396b

• Accession: MIMAT0005725
• Sequence: 14 - uuccacagcuuucuugaacu - 33
• Deep sequencing: 7021 reads, 2 experiments
• Evidence: experimental; Array [2]

References

1. PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2. PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).