Stem-loop sequence vvi-MIR395h

Accession

MI0006563 (change log)

Description

Vitis vinifera miR395h stem-loop

Gene family

MIPF0000016; MIR395

Literature search

6 open access papers mention vvi-MIR395h
(23 sentences)

Stem-loop

   --- uc  cua         ug c       c      ccu  ucuaa 
5'    g  cc   gaguucccu  a cacuuca ugggga   uc     u
      |  ||   |||||||||  | ||||||| ||||||   ||      
3'    c  gg   cucaagggg  u gugaagu auccuu   ag     u
   uau gu  -uc         gu u       c      --c  uaaua 

Deep sequencing

7235 reads, 450 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (12X; GCA_000003745.2): chr1: 6566652-6566743 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from vvi-MIR395h

• vvi-MIR395m: chr1: 6557811-6557902 [+]
• vvi-MIR395l: chr1: 6559098-6559184 [+]
• vvi-MIR395i: chr1: 6562642-6562727 [+]
• vvi-MIR395h: chr1: 6566652-6566743 [+]

Database links

• EntrezGene:MIR395H
• miRBase Tracker:MI0006563

Mature sequence vvi-miR395h

• Accession: MIMAT0005718
• Sequence: 62 - cugaaguguuugggggaacuc - 82
• Deep sequencing: 7153 reads, 2 experiments
• Evidence: experimental; Array [2]

References

1. PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2. PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).