Stem-loop sequence vvi-MIR395f

AccessionMI0006561 (change log)
DescriptionVitis vinifera miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention vvi-MIR395f
(23 sentences)

Stem-loop 
   -- u  -  ua         ug c       c      -  uuc 
5'   g ac cc  gaguucccc  a cacuuca ugggga uc   u
     | || ||  |||||||||  | ||||||| |||||| ||   c
3'   c ug gg  cucaagggg  u gugaagu acccuu ag   u
   ua -  u  uc         gu u       c      c  uaa
Get sequence
Deep sequencing
7257 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr1: 6489542-6489627 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR395f
vvi-MIR395gchr1: 6482113-6482198 [+]
vvi-MIR395fchr1: 6489542-6489627 [+]
Database links

Mature sequence vvi-miR395f

Accession MIMAT0005716
Sequence

56 -  

cugaaguguuugggggaacuc

 - 76

Get sequence
Deep sequencing7152 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).