Stem-loop sequence vvi-MIR395c

AccessionMI0006558 (change log)
DescriptionVitis vinifera miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention vvi-MIR395c
(23 sentences)

Stem-loop
   --gucc  ua         ug c       c      ccu  uc  g 
5'       cc  gaguucccu  a cacuuca ugggga   uc  ua u
         ||  |||||||||  | ||||||| ||||||   ||  ||  
3'       gg  cucaagggg  u gugaagu auccuu   ag  au u
   uaccgu  uc         gu u       c      --c  ua  a 
Get sequence
Deep sequencing
7235 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr1: 6499914-6500005 [-]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR395c
vvi-MIR395echr1: 6505248-6505339 [+]
vvi-MIR395bchr1: 6502664-6502753 [+]
vvi-MIR395cchr1: 6499914-6500005 [-]
Database links

Mature sequence vvi-miR395c

Accession MIMAT0005713
Sequence

62 - 

cugaaguguuugggggaacuc

 - 82

Get sequence
Deep sequencing7153 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).