Stem-loop sequence vvi-MIR395b

AccessionMI0006557 (change log)
DescriptionVitis vinifera miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention vvi-MIR395b
(23 sentences)

Stem-loop 
   --gucc  ua          uac       ---cug   auc   uc 
5'       cc  gaguuccccu   cacuuca      ggg   uuc  u
         ||  ||||||||||   |||||||      |||   |||   
3'       gg  cucaaggggg   gugaagu      ucc   aag  a
   uaccgu  uc          uuu       caugca   -gu   ua
Get sequence
Deep sequencing
7182 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr1: 6502664-6502753 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR395b
vvi-MIR395cchr1: 6499914-6500005 [-]
vvi-MIR395bchr1: 6502664-6502753 [+]
vvi-MIR395echr1: 6505248-6505339 [+]
Database links

Mature sequence vvi-miR395b

Accession MIMAT0005712
Sequence

60 -  

cugaaguguuugggggaacuc

 - 80

Get sequence
Deep sequencing7153 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).