Stem-loop sequence vvi-MIR390

AccessionMI0006552 (change log)
DescriptionVitis vinifera miR390 stem-loop
Gene family MIPF0000101; MIR390
Literature search

4 open access papers mention vvi-MIR390
(19 sentences)

Stem-loop 
   --         u          g             --a  --c       aaa   uugu      -    a 
5'   agaaucugu aagcucagga ggauagcgccaug   gc   augauga   uga    ugaguu gaaa u
     ||||||||| |||||||||| |||||||||||||   ||   |||||||   |||    |||||| ||||  
3'   ucuugggca uuugaguccu ucuaucgcggugu   ug   uacuacu   guu    guucga cuuu u
   cu         c          a             gug  uuu       -gg   uuuu      u    u
Get sequence
Deep sequencing
16363 reads, 950 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr6: 8159519-8159658 [+]
intergenic
Database links

Mature sequence vvi-miR390

Accession MIMAT0005707
Sequence

11 -  

aagcucaggagggauagcgcc

 - 31

Get sequence
Deep sequencing16237 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).