Stem-loop sequence vvi-MIR171f

AccessionMI0006541 (change log)
DescriptionVitis vinifera miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention vvi-MIR171f
(16 sentences)

Stem-loop 
   --uugaa     c          a            a    ga   a   uu 
5'        gaaag gauguuggug gguucaaucuga gauu  uuu ugc  g
          ||||| |||||||||| |||||||||||| ||||  ||| |||   
3'        uuuuc cuauaaccgc ccgaguuagacu cuag  aaa aug  a
   cgguguc     a          g            -    uc   a   ua
Get sequence
Deep sequencing
1118 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr9: 7012498-7012600 [+]
intergenic
Database links

Mature sequence vvi-miR171f

Accession MIMAT0005696
Sequence

73 -  

uugagccgcgccaauaucacu

 - 93

Get sequence
Deep sequencing1099 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).