Stem-loop sequence vvi-MIR171e

AccessionMI0006540 (change log)
DescriptionVitis vinifera miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention vvi-MIR171e
(17 sentences)

Stem-loop 
   ------       aagc          a         c  a  -  -ga      aa 
5'       ggaaagu    gauguuggug gguucaauc ga ga cg   uuuacg  g
         |||||||    |||||||||| ||||||||| || || ||   ||||||   
3'       ucuuuca    cuauaaccgc ccgaguuag cu cu gc   aaaugc  a
   gaaucg       ----          g         u  -  a  aag      cg
Get sequence
Deep sequencing
1968 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 5203318-5203420 [+]
intergenic
Database links

Mature sequence vvi-miR171e

Accession MIMAT0005695
Sequence

70 -  

ugauugagccgcgccaauauc

 - 90

Get sequence
Deep sequencing1952 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).