Stem-loop sequence vvi-MIR171d

AccessionMI0006539 (change log)
DescriptionVitis vinifera miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

4 open access papers mention vvi-MIR171d
(14 sentences)

Stem-loop 
   --uagauac   a       a               a   u u     aa 
5'          acg gauauug uacgguucaauuaga agc g guucu  g
            ||| ||||||| ||||||||||||||| ||| | |||||   
3'          ugc cuauaac gugccgaguuaguuu uug c caaga  u
   ucuucaucc   a       c               g   u u     au
Get sequence
Deep sequencing
1144 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr10: 962566-962665 [+]
intergenic
Database links

Mature sequence vvi-miR171d

Accession MIMAT0005694
Sequence

67 -  

ugauugagccgugccaauauc

 - 87

Get sequence
Deep sequencing1144 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).