Stem-loop sequence vvi-MIR171b

AccessionMI0006537 (change log)
DescriptionVitis vinifera miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

4 open access papers mention vvi-MIR171b
(16 sentences)

Stem-loop 
   -- gg                 c       u  ag          -  ga 
5'   u  ggggagguauuggcgug cucaauu aa  acaugguuag au  a
     |  ||||||||||||||||| ||||||| ||  |||||||||| ||   
3'   g  uuccucuauaacugcgc gaguuag uu  uguaccgauu ua  g
   ac uu                 c       u  ag          a  ga
Get sequence
Deep sequencing
4980 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr12: 5542399-5542497 [-]
intergenic
Database links

Mature sequence vvi-miR171b

Accession MIMAT0005692
Sequence

69 -  

ugauugagccgcgucaauauc

 - 89

Get sequence
Deep sequencing4973 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).