Stem-loop sequence vvi-MIR169u

AccessionMI0006535 (change log)
DescriptionVitis vinifera miR169u stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169u
(15 sentences)

Stem-loop 
   --     g    u        gau         -uu      uu  a     g ac 
5'   agggu gaau gagucaag   gacuugccg   auauau  gc gaagg c  g
     ||||| |||| ||||||||   |||||||||   ||||||  || ||||| |  c
3'   ucccg uuug cucaguuc   uugaacggc   ugugua  cg uuucc g  a
   uc     g    u        -ag         cau      -u  a     g gg
Get sequence
Deep sequencing
1484 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16409401-16409510 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR169u
vvi-MIR169tchr11: 16399567-16399676 [+]
vvi-MIR169uchr11: 16409401-16409510 [+]
vvi-MIR169rchr11: 16415131-16415239 [+]
Database links

Mature sequence vvi-miR169u

Accession MIMAT0005690
Sequence

11 -  

ugagucaaggaugacuugccg

 - 31

Get sequence
Deep sequencing1358 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).