Stem-loop sequence vvi-MIR169t

AccessionMI0006534 (change log)
DescriptionVitis vinifera miR169t stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169t
(15 sentences)

Stem-loop 
   --     g    c        gau         -a       uu  g     a   g 
5'   agggu gaau gagucaag   gacuugccg  uauauau  gc gaagg cuu c
     ||||| |||| ||||||||   |||||||||  |||||||  || ||||| |||  
3'   ucccg uuug cucaguuc   uugaacggc  augugua  cg uuucc ggg a
   uc     g    a        -ag         ca       -u  a     -   u
Get sequence
Deep sequencing
231 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16399567-16399676 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR169t
vvi-MIR169tchr11: 16399567-16399676 [+]
vvi-MIR169uchr11: 16409401-16409510 [+]
Database links

Mature sequence vvi-miR169t

Accession MIMAT0005689
Sequence

11 -  

cgagucaaggaugacuugccg

 - 31

Get sequence
Deep sequencing106 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).